“Covid-19: Bevisen för det globala bedrägeriet”

Covid-19

26 december 2020
Iain Davis
https://nyadagbladet.se/debatt/covid-19-bevisen-for-det-globala-bedrageriet/

Covid-19 och regeringarnas efterföljande åtgärder verkar vara en del av en internationell konspiration för att begå bedrägeri. Det ser ut som om det inte finns några bevis för att ett virus som heter SARS-CoV-2 orsakar en sjukdom som heter Covid-19.

Ibland måste du följa din intuition. Jag är ingen expert på genetik och som alltid, rätta mig om jag har fel. Men min uppmärksamhet riktades på en forskningsrapport som publicerades av den spanska medicinska tidskriften D-Salud-Discovery. Deras rådgivande styrelse med framstående kvalificerade läkare och forskare ger deras forskning ytterligare trovärdighet. Deras påstående är häpnadsväckande.

De genetiska primrarna och sonderna som används i RT-PCR testerna för att identifiera SARS-CoV-2 letar inte efter något specifikt. Jag följde de söktekniker som beskrivs i den här engelska översättningen av deras rapport och kan bekräfta noggrannheten i deras påståenden om nukleotidsekvenserna som anges i protokollen från Världshälsoorganisationen. Du kan göra detsamma.

D-Salud-Discovery säger att det inte finns några tester som kan identifiera SARS-CoV-2. Följaktligen är alla påståenden om den hävdade inverkan av COVID-19 på befolkningens hälsa grundlösa.

Hela den officiella covid-19-berättelsen är en illusion. Det finns uppenbarligen ingen vetenskaplig grund för någon del av den.

Om dessa påståenden är korrekta kan vi konstatera att det inte finns några bevis för en pandemi, bara en illusion av en sådan. Vi har lidit obeskrivliga förluster utan någon uppenbar anledning, förutom ambitionerna hos skrupelfria despoter som vill förändra den globala ekonomin och vårt samhälle så att den passar deras syften.

Genom att göra detta har denna “parasitklass” begått otaliga brott. Dessa brott kan och skall utredas samt lagföras vid domstol.

Identifikation av vad egentligen?

Världshälsoorganisationen (WHO) klassificerade COVID-19 (COronaVIrus Disease 2019). De förklarade en global Covid-19 pandemi den 11 mars 2020.

WHO:s laboratorieundersökningsvägledning säger:

Den etiologiska patogenen [orsakssamband för sjukdomen] som är ansvarig för klustret av fall av lunginflammation i Wuhan har identifierats som ett nytt betacoronavirus, (i samma familj som SARS-CoV och MERS-CoV) via nästa generations sekvensering (NGS) från odlade virus eller direkt från prover från flera lunginflammationspatienter.

WHO:s påstående är att SARS-CoV-2-viruset orsakar sjukdomen COVID-19. De hävdar också att detta virus har identifierats tydligt av forskare i Wuhan.

I WHO:s Novel Coronavirus 2019-nCov Situation Report 1 säger de:

De kinesiska myndigheterna identifierade en ny typ av coronavirus, som isolerades den 7 januari 2020… Den 12 januari 2020 delade Kina den genetiska sekvensen av det nya coronaviruset som länder kan använda för att utveckla specifika diagnostiska kit.

Dessa två uttalanden från WHO antyder tydligt att SARS-CoV-2-viruset isolerades (vilket betyder renat för studier) och sedan identifierades genetiska sekvenser från det isolerade provet. Från detta utvecklades diagnostiska kit och distribuerades globalt för att testa viruset i städer och samhällen runt om i världen. Enligt WHO och kinesiska forskare är dessa tester kapabla att hitta viruset som orsakar COVID-19.

WHO säger också:

Genom att arbeta direkt från sekvensinformation, utvecklade teamet en serie av genetiska amplifieringsanalyser (PCR), som används av laboratorier.

wuhanForskare i Wuhan tog tidigt fram metoder att analysera prov från patienter men de utgick inte från något isolerat prov av det så kallade SARS-CoV-2-viruset utan endast sekvensinformation.

Wuhan-forskarna utvecklade sina genetiska amplifieringsanalyser från “sekvensinformation” eftersom det inte fanns något isolerat, renat prov av det så kallade SARS-CoV-2-viruset. De visade också elektronmikroskopbilder av de nyligen upptäckta virionerna (den taggiga proteinkulan innehållande viralt RNA).

Sådana proteinstrukturer är emellertid inte unika. De ser ut precis som andra runda vesiklar, som endocytiska vesiklar och exosomer.

Virologer hävdar att det inte är möjligt att “isolera” ett virus eftersom det bara replikerar inuti värdceller. De tillägger att Kochs postulat inte gäller eftersom de relaterar till bakterier (som är levande organismer). Istället observerar virologer virusets cytopatogena effekter (CPE), som orsakar cellmutation och nedbrytning, i cellkulturer.

När kinesiska forskare först sekvenserade hela SARS-CoV-2-genomet observerade de CPE i Vero E6- och Huh7-celler. Vero E6 är en odödliggjord cellinje från apa och Huh7 är odödliggjorda cancerceller (tumörceller). Det betyder att de har bibehållits in vitro (i petriskålskulturer) i många år.

Centralt i den officiella SARS-CoV-2 berättelsen är tanken att det är ett zoonotiskt virus som kan överbrygga gapet mellan arter, från djur till människor. När forskare från USA:s CDC “infekterade” olika celler med det nya viruset noterade de följande:

Vi undersökte kapaciteten hos SARS-CoV-2 att infektera och replikera i flera vanliga primata och humana cell-linjer, inklusive humana adenokarcinomceller (A549) [lungceller], humana leverceller (HUH7.0) och humana embryonala njurceller (HEK-293T), förutom Vero E6 och Vero CCL81 [apaceller] … Ingen cytopatisk effekt observerades i någon av cellinjerna utom i Vero-celler [celler från apa] … HUH7.0- och 293T-celler visade endast blygsam viral replikation och A549-celler [humana lungvävnadsceller] var oförenliga med en SARS-CoV-2-infektion.

CDC observerade ingen CPE i humana celler. De såg inga bevis för att detta påstådda virus orsakade någon mänsklig sjukdom. Inte heller visade detta påstådda humana virus någon anmärkningsvärd replikering i mänskliga celler, vilket tyder på att en infektion från människa till människa skulle vara omöjlig.

Med tanke på detta problem introducerade ett team av polska forskare detta sekvenserade “virus” till humana epitelceller (luftvägsceller). De observerade effekterna på dessa HAE-kulturer i 5 dagar. De noterade mycket större replikering än CDC-forskarna men uppgav i slutändan:

Vi såg ingen frisättning av viruset från den basolaterala sidan av HAE-kulturen.

Det betyder att de inte såg några bevis för att de antagna virionerna bryter igenom cellväggens membran. Återigen tyder detta på att det så kallade viruset inte är smittsamt hos människor.

Det är inte klart att SARS-CoV-2 är ett humant virus som kan orsaka sjukdom. Det kanske inte ens existerar fysiskt. Det är kanske inget annat än ett koncept baserat på prediktiva genetiska sekvenser?

coronavirus

Artikelförfattaren Iain Davis för fram att forskning inte visar att det så kallade SARS-CoV-2-viruset är smittsamt hos människor.

Upptäcktsresan

Wuhan Center for Disease Control and Prevention och Shanghai Public Health Clinical Center publicerade det första fullständiga SARS-CoV-2 genomet (MN908947.1). Detta har uppdaterats många gånger. Emellertid var MN908947.1 den första genetiska sekvensen som beskriver den påstådda COVID-19 etiologiska patogenen (SARS-CoV-2).

Alla efterföljande påståenden, tester, behandlingar, statistik, vaccinutveckling och resulterande policyer baseras på denna sekvens. Om testerna för detta nya virus inte identifierar något som kan orsaka sjukdom hos människor, är hela covid-19 berättelsen inget annat än en charad.

Wuhan-forskarna uppgav att de effektivt hade sammanställt den SARS-CoV-2 genetiska sekvensen genom att matcha fragment som hittades i prover med andra, tidigare upptäckta genetiska sekvenser. Från det samlade materialet hittade de en 87,1 procent matchning med SARS coronavirus (SARS-CoV). De använde “de novo assembly” och riktad PCR-teknik och hittade 29 891 baspar som delade en 79,6 procent sekvensmatchning med SARS-CoV.

De var tvungna att använda “de novo assembly” eftersom de inte hade någon tidigare kunskap om den korrekta sekvensen eller ordningen av dessa fragment. Helt enkelt, WHO:s påstående att kinesiska forskare isolerade viruset den 7 januari är falskt.

Wuhan-teamet använde 40 cykler av RT-qPCR amplifiering för att matcha fragment av cDNA (komplementär DNA konstruerat av samplade RNA fragment) med det publicerade SARS-coronavirusgenomet (SARS-CoV). Tyvärr är det inte heller klart hur exakt det ursprungliga SARS-CoV-genomet är.

År 2003 studerade ett team forskare från Hong Kong 50 patienter med svår akut respiratorisk syndrom (SARS). De tog prover från två av dessa patienter och utvecklade en odling i leverceller från apa.

De skapade 30 kloner av det genetiska materialet de hittade. De kunde inte hitta bevis på något annat känt virus, i bara ett av dessa klonade prover hittade de genetiska sekvenser av “okänt ursprung”.

Genom att undersöka dessa okända RNA-sekvenser fann de att 57 procent matchade bovint coronavirus och murint hepatitvirus och drog slutsatsen att det var av familjen Coronaviridae. Med hänsyn till att dessa sekvenser pekar på ett nytt upptäckt SARS-CoV virus (nya upptäckter är ambrosia för forskare), utformade de RT-PCR primrar för att testa för detta nya virus.

Forskarna sa:

Primrar för att detektera det nya viruset utformades för RT-PCR detektion av detta humana lunginflammations-associerade coronavirus-genomet i kliniska prover. Av de 44 nasofaryngeala proverna som var tillgängliga från de 50 SARS-patienterna hade 22 bevis på humant lunginflammations-associerat coronavirus-RNA.

Hälften av de testade patienterna, som alla hade samma symtom, testades positivt för detta nya påstådda virus. Ingen vet varför den andra hälften testades negativt för detta nya SARS-CoV virus. Frågan ställdes inte.

Detta förmodade viruset hade bara en 57 procent sekvensmatchning med påstådda kända coronavirus. De andra 43 procent var bara “där”. Sekvenserad data producerades och registrerades som ett nytt genom med GenBank-nummer AY274119.

Wuhan-forskarna hittade därefter en 79,6 procent sekvensmatchning med AY274119 och kallade det därför en ny stam av SARS-CoV (2019-nCoV som så småningom döptes om till SARS-CoV-2). Ingen, i något stadium av denna process, hade producerat något isolerat, renat prov av något virus. Allt de hade var matchningar i procent av sekvenser till andra matchningar i procent.

Isolera ingenting

Forskare är mycket irriterade eftersom de säger att viruset har isolerats men ingen tror på dem. Detta beror på att ännu ingen har tillhandahållit ett enda renat prov av SARS-CoV-2 viruset. Vad vi istället har är ett färdigt genom och som vi håller på att upptäcka är det inte särskilt övertygande.

Undersökande journalisterna Torsten Engelbrecht och Konstantin Demeter frågade några av forskarna som sa att de hade bilder av SARS-C0V-2 virioner för att bekräfta att dessa var bilder av ett isolerat, renat virus. Ingen av dem kunde det.

I Australien meddelade forskare från Doherty Institute att de hade isolerat SARS-CoV-2 viruset. När de ombads att klargöra sa forskarna:

Vi har korta (RNA) sekvenser från den diagnostiska testen som kan användas i de diagnostiska testerna.

Detta förklarar varför den australiska regeringen säger:

Tillförlitligheten hos covid-19 tester är osäker på grund av den begränsade evidensbasen … Det finns begränsad information tillgänglig för att bedöma noggrannheten och kliniska användbarheten av tillgängliga covid-19 tester.

I Storbritannien skrev en grupp oroade akademiker i juli ett brev till Storbritanniens premiärminister Boris Johnson där de bad honom att:

Producera oberoende peer-reviewed vetenskapliga bevis som visar att covid-19-viruset har isolerats.

Hittills har de inte fått något svar.

På samma sätt gjorde brittiska forskaren Andrew Johnson en “Freedom of Information Request” till “Public Health England (PHE)“. Han bad dem att ge honom sina registeruppgifter som beskriver isoleringen av ett SARS-COV 2-virus. De svarade:

PHE kan bekräfta att det inte besitter information på det sätt som föreslås av din begäran.

Den kanadensiska forskaren Christine Massey gjorde en liknande begäran om informationsfrihet och bad den kanadensiska regeringen om samma sak. På vilket den kanadensiska regeringen svarade:

Efter att ha genomfört en grundlig sökning, beklagar vi att meddela dig att vi inte kunde hitta några uppgifter som kan ge svar på din begäran.

I USA anger Center for Disease Control (CDC) RT-PCR Diagnostic Panel:

… Inga kvantifierade virusisolat av 2019-nCoV är för närvarande tillgängliga … Detektion av viralt RNA kanske inte indikerar förekomsten av infektiöst virus eller att 2019-nCoV är orsakssubstansen för kliniska symtom.

Senast uppdaterad den 13 juli 2020 har CDC ännu inte lyckats extrahera ett rent virusprov från någon patient som sägs ha sjukdomen covid-19. De medger öppet att deras tester inte nödvändigtvis visar om SARS-CoV-2 är närvarande eller orsakar covid-19.

Vi får höra att inget av det här betyder något. Att vi är okunniga och inte förstår virologi. Därför måste vi acceptera bilder av saker som vi vet kan vara något annat och genetiska sekvenser (som kan vara allt annat) som ett avgörande bevis på att detta virus och den sjukdom som det ska orsaka är verkliga.

Det är trots att den så kallade pandemin pågått under lång tid oklart om någon lyckats isolera SARS-CoV-2-viruset

Testar för ingenting

WHO och varje regering, tankesmedja, politisk styrkommitté, regeringens vetenskapliga rådgivare, överstatliga institutioner och andra som främjar den officiella berättelsen om covid-19, hävdar att SARS-CoV-2 orsakar covid-19.

Medan ingen någonsin har producerat ett prov av detta förmodade virus har det påstådda SARS-CoV-2-genomet publicerats. Informationen finns offentligt tillgänglig.

Viktiga genetiska sekvenser, i SARS-CoV-2 genomet, sägs ha specifika funktioner. Dessa är de målproteiner som forskare testar för att identifiera förekomsten av ”viruset”. Dessa inkluderar:

· RNA-polymeras (RdRp) gen – Detta gör det möjligt för SARS-CoV-2-RNA att replikera inuti cytoplasman i covid-19 sjuka epitelceller.

· S-gen (Orf2) – detta glykoprotein bildar spetsen på SARS-CoV-2 virionsytan vilket förmodligen underlättar SARS-CoV-2 bindning till ACE2-receptorerna på celler, vilket gör att RNA inuti virionproteinskalet (kapsid) kan passera in i den nu infekterade cellen.

· E-gen (Orf1ab) – litet membranprotein som används vid viral “assembly”

· N-gen (Orf9a) – nukleokapsidgenen som binder RNA i kapsidbildning

WHO upprätthåller ett offentligt tillgängligt register över RT-PCR primrar och sonder som används för att testa för SARS-CoV-2. Primrarna är specifika nukleotidsekvenser som binder (annealer) till antisense- och senssträngarna hos det syntetiserade cDNA (de kallas framåt respektive bakåt primrar).

cDNA-trådarna separeras när de värms upp och sammanförs när de kyls. Före kylning införs nukleotidsekvenser som kallas sonder för att fästa på specifika målregioner i det misstänkta virusgenomet. Under förstärkning, när regionerna mellan primrarna förlängs, när en primer träffar en sond, sönderfaller sonden och frigör ett fluorescerande eller färgämne som sedan kan läsas av forskare.

Det är identifieringen av dessa markörer som forskare påstår bevisa förekomsten av SARS-CoV-2 i ett prov.

Något annat som är offentligt tillgängligt är Basic Local Alignment Search Tool (BLAST). Detta gör det möjligt för vem som helst att jämföra publicerade nukleotidsekvenser med alla som lagras i den genetiska databasen, GenBank, hos U.S. National Institutes of Health (NIH). Därför kan vi BLAST de påstådda SARS-CoV-2 primrarna, sonderna och mål-gensekvenserna.

WHO:s framåt-, bakåt-primrar och sond-protokoll, för det påstådda virusgenomet SARS-CoV-2, är baserade på RdRp, Orf1, N och E genprofiler. Vem som helst kan köra dem genom BLAST för att se vad som kan hittas.

Den vitala RdRp nukleotidsekvensen som används som en framåtriktad primer är – ATGAGCTTAGTCCTGTTG. Om vi ​​kör en nukleotid BLAST ser vi att detta är registrerat som ett fullständigt SARS-CoV-2-isolat med en 100 procent matchad sekvensidentitet. På liknande sätt visar den omvända E-primersekvensen – ATATTGCAGCAGTACGCACACA – närvaron av Orf1ab-sekvensen som också identifierar SARS-CoV-2.

Men BLAST gör det också möjligt för oss att söka i nukleotidsekvenserna för det mikrobiella och humana genomet. Om vi ​​söker efter RdRp SARS-CoV-2-sekvensen hittas 99 mänskliga kromosomer (Eller kromosomfragment) med en 100 procent sekvensidentitetsmatchning. Orf1ab (E-genen) returnerar 90 med en 100 procent sekvensidentitetsmatchning till humana kromosomer.

Att göra detsamma för dessa sekvenser med en mikrobiell sökning hittar 92 mikrober med en 100 procent matchning till SARS-CoV-2 E-genen och 100 matchade mikrober, med en 100 procent sekvensidentitet, till den vitala SARS-CoV-2 RdRp genen.

Närhelst vi kontrollerar de så kallade unika genetiska markörerna för SARS-CoV-2, uppräknade i WHO-protokollen, hittar vi fullständiga eller höga procentuella matchningar med olika fragment av det mänskliga genomet. Detta antyder att de genetiska sekvenserna, som ska identifiera SARS-CoV-2, inte är unika. De kan vara allt från mikrobiella sekvenser till fragment av mänskliga kromosomer.

Så kallade faktakontrollörer, som Reuters’ Health Feedback project, har snabbt avvisat påståenden från dem som har uppmärksammat den uppenbara bristen på specificitet i det förmodade SARS-CoV-2 genomet.

Med en massa halmgubbs-argument som att “detta påstående suggererar att varje test förväntas vara positiv” (vilket påståendet inte gör), deras blottläggnings-försök låter ungefär så här:

Primrarna är utformade för att binda till specifika nukleotidsekvenser som är unika för viruset. Framåt-primern kan binda till en viss kromosom men bakåt-primern binder inte till samma kromosom och därför så finns inte kromosomen i SARS-CoV-2 viruset. Eftersom framåt och bakåt primrarna omsluter sekvensen som ska amplifieras är cDMA-sekvensen mellan primrarna dessutom unik för viruset.

Detta verkar avsiktligt förvränga betydelsen av dessa resultat genom att framföra ett argument som ingen annan, förutom “faktakontrollörerna”, gör. BLAST sökningar visar att dessa målsekvenser inte är unika för SARS-CoV-2. Inte heller behöver alla mål hittas för att ett resultat ska anses vara positivt.

Marockanska forskare undersökte epidemiologin av marockanska påstådda fall av SARS-CoV-2. Nio procent var positiva för tre gener, arton procent var positiva för två gener och sjuttiotre procent för bara en. Som vi just har diskuterat kan många ha varit positiva för ingen.

Detta är helt i linje med WHO:s testriktlinjer. De säger:

En optimal diagnos består av ett NAAT [nukleinsyraamplifieringstest] med minst två genom-oberoende mål för SARS-CoV-2; men i områden där spridningen är utbredd kan en enkel ett-måls algoritm användas… Ett eller flera negativa resultat utesluter inte nödvändigtvis SARS-CoV-2 infektionen.

Oavsett de falska argumenten från välfinansierade “faktakontrollörer”. Om framåt- och bakåt-primrarna identifierar skräp, kanske en är fragmentet av en kromosom och den andra en mikrobiell sekvens, så är den förstärkta regionen mellan dem troligen också skräp.

Argumentet att RT-PCR bara hittar RNA är vilseledande. Naturlig transkription (separering av DNA strängar) sker under “gene expression”. Ingen säger att hela kromosomer eller mikrober sekvenseras i det påstådda SARS-CoV-2 genomet. Men de kan från vad vi vet. De säger att de påstådda markörerna, som används för att testa för detta påstådda virus, inte är lämpliga för syftet.

RT-PCR-tester sekvenserar inte hela genomet. De letar efter incidenter med specifik sond fluorescens för att indikera närvaron av sekvenser som sägs existera. Dessa sekvenser definieras av MN908947.1 och efterföljande uppdateringar. Dessa primrar och sonder påvisar eventuellt inget annat än RNA-matchningar extraherade från icke-kodande, ibland kallad “skräp” DNA (cDNA).

Exempelvis är SARS-CoV-2 S genen avsedd att vara mycket specifik för SARS-CoV-2 virus genomet. Målsekvensen är – TTGGCAAAATTCAAGACTCACTTTC. En mikrobiell BLAST sökning returnerar 97 mikrobiella matchningar med 100 procent identitetssekvensmatchning. Den lägsta identitetsprocenten, bland de 100 bästa, är 95 procent. En human BLAST hittar också en 100 procent sekvensmatchning till 86 humana kromosomfragment.

Oavsett var du tittar i det förmodade SARS-CoV-2 genomet, finns det inget i WHO:s testprotokoll som tydligt identifierar vad det är. Hela genomet kan vara falskt. Testerna bevisar inte förekomsten av SARS-CoV-2. Allt de avslöjar är en soppa av ospecificerat genetiskt material.

Om så är fallet, eftersom det inte finns några isolat eller renade prover av viruset, utan en fungerande test, finns det inga bevis för att SARS-CoV-2 existerar. Därför finns det inga bevis för att det finns en sjukdom som heter covid-19.

Detta visar att det inte finns någon vetenskaplig grund för några påståenden om covid-19 falltal, sjukhusinläggningar eller dödlighet. Alla åtgärder som vidtas för att bekämpa detta dödliga virus grundar sig mycket möjligt på ingenting.

Beviskraftigt bedrägeri

Bedrägeri är en kriminell handling. Den juridiska definitionen av bedrägeri är:

Någon bedräglig praxis eller uppsåtlig anordning, som används i avsikt att beröva en annan sin rätt eller på något sätt att skada personen.

Den juridiska definitionen av en konspiration är:

En kombination eller förbund mellan två eller flera personer bildad i syfte att genom sina gemensamma ansträngningar begå någon olaglig eller kriminell handling

Det verkar som om de som hävdar att vi står inför en pandemi inte har gett några bevis för att ett virus som heter SARS-CoV-2 orsakar en sjukdom som heter covid-19. All information som ger starka bevis på att så mycket väl kan vara fallet är lätt tillgänglig i det offentliga rummet. Vem som helst kan läsa den.

För att det ska föreligga ett bedrägeri måste bedrägeriet vara medvetet. Avsikten måste vara att avsiktligt beröva andra sina rättigheter eller skada dem på något annat sätt. Om det finns bevis på samverkan mellan individer och/eller organisationer för att begå bedrägeri, är detta en konspiration (“in Common Law jurisdictions“) eller ett Joint Criminal Enterprise (JCE) enligt internationell rätt.

Det verkar som covid-19 medvetet har använts som en casus belli för att föra krig mot mänskligheten. Vi har fängslats i våra egna hem, vår rörlighet har begränsats, yttrandefriheten urholkats, rättigheterna till protest har begränsats, blivit separerade från nära och kära, våra företag har förstörts, psykologiskt bombarderade, nedtystade och terroriserade.

Ännu värre, det finns inte några bevis för en aldrig tidigare skådat dödlighet, däremot förekom det ovanliga toppar i dödsfallstatistiken. Dessa korrelerar exakt med Lockdown åtgärderna som innebar tillbakadragandet av de hälsovårdstjänster vi betalar för och en omorientering av folkhälsovården för att behandla en påstådd sjukdom med utestängning av alla andra.

Vidare föreslås det av dem som har propagerat covid-19 historien att denna påstådda sjukdom ger ett rättfärdigande för den fullständiga omstruktureringen av den globala ekonomin, våra politiska system, samhällen, kulturer och mänskligheten själv.

För att få delta i deras så kallade “nya normala”, som omfattar den totala förändringen av hela vårt samhälle utan vårt samtycke, insisterar de på att vi underkastar oss deras villkor.

Dessa inkluderar, men är inte begränsade till, biometrisk övervakning av alla, centraliserad kontroll och övervakning av alla våra transaktioner, förtryckande affärs- och sociala restriktioner och ett effektivt krav på att vi inte har någon rätt till suveränitet över våra egna kroppar. Detta utgör definitionen för slaveri.

Det råder ingen tvekan om att vi har berövats våra rättigheter och skadats. I “Angloamerikansk rätt” antas oskuld men bevisen för att medvetet skada har orsakats av en internationell konspiration är överväldigande. Destruktiv politik, antagen av regeringar över hela världen, stammade klart från globalistiska tankesmedjor och överstatliga institutioner långt före uppkomsten av denna obefintliga pandemi.

I Napoleonskodens jurisdiktioner antas skuld. För att de anklagade konspiratörerna ska kunna bevisa sin oskuld måste de visa att de trots sina omätbara resurser kollektivt inte har kunnat få tillgång till eller förstå något av de fritt tillgängliga bevis som tyder på att covid-19 är en myt.

De som är ansvariga för brottet konspiration för att begå globalt bedrägeri ska åtalas. Om de anses skyldiga bör de fängslas medan vi andra fortsätter med att försöka reparera den skada de redan har orsakat.

Källa: Off Guardian -COVID19 – Evidence Of Global Fraud



Kategorier:Hälsa, Rättsstat, Världspolitik

Etiketter:, ,

<span>%d</span> bloggare gillar detta: